ASV Sequence GBOL_ASV_ID_52261

Date added 2022-08-02 06:12:02
Provided in projects: Project: DSUB-558 with original sequence id: P142690-1734
Project: Introduction asv registry with original sequence id: P142690-2025-3600
Project: Introduction asv registry with original sequence id: P142690-1734
Project: smf_dummy with original sequence id: P142690-2025-3600
Primers
mlCOIintF, dgHCO2198

TTTATCAGTTTTAATATATCACTCTGGTTTATCTGTAGATTTAACTATTTTTTCTCTTCATATAGCTGGTATTTCTTCAATTTTAGGAGCAGTTAATTTTATATCTACAATTTTTAATATAAAATTTATAGGTATTAATTTTGATATAATAACTTTATTTATTTGATCAATTTTAATTACTGTAATTTTGCTATTATTATCTTTACCTGTTCTTGCGGGAGCAATTACAATATTATTAACTGATCGTAATTTTAATACATCTTTTTTTGATCCTTCAGGAGGAGGAGATCCTATTTTATATCAACATTTATTT

Taxon Reference database Taxonomy Identity [%] evalue Date of assignment
Epidapus_atomarius from ASV table 168 Arthropoda, Insecta, Diptera, Sciaridae, Epidapus, Epidapus_atomarius 2025-12-03 13:23:57
Epidapus_atomarius from ASV table 170 Arthropoda, Insecta, Diptera, Sciaridae, Epidapus, Epidapus_atomarius 2025-12-04 23:59:38
Epidapus atomarius (De Geer, 1778) GBOL Animalia, Arthropoda, Hexapoda, Insecta, Neoptera, Diptera, Nematocera, Sciaridae, Epidapus, Epidapus, Epidapus atomarius (De Geer, 1778) 100.0000 0E-8 2025-12-05 00:00:47

Occurrences Total of 15 occurrences in 63 samples: ASV table 154 version 1 Download
Total of 3 occurrences in 98 samples: ASV table 160 version 1 Download
Total of 3 occurrences in 98 samples: ASV table 168 version 1 Download
Total of 0 occurrences in 63 samples: ASV table 170 version 1 Download
Total of 3 occurrences in 98 samples: ASV table 173 version 1 Download