ASV Sequence GBOL_ASV_ID_4809
Date added | 2022-08-01 13:21:24 |
Provided in projects: |
Project: Björns Testprojekt with original sequence id: 182e43316ac33798205c9bbaeae3244b Project: Björns Testprojekt with original sequence id: OTU_101 Project: Biodiversity Hotspots in Danish Marine Waters with original sequence id: COI_ASV_919 Project: Sandras Testprojekt with original sequence id: 182e43316ac33798205c9bbaeae3244b |
Primers |
TCTATCTTCAAGAATTGCTCATAGTGGTGCATCTGTAGATTTAGCAATTTTTTCTTTACATCTAGCAGGAATCTCATCTATTCTTGGATCAGTAAATTTTATTACAACAGCTATTAATATACGTTCAAACGGTATTACTCTTGATCGAATACCTTTATTTGTTTGATCTGTAATTATTACTACTATTTTACTTCTTTTATCTCTCCCAGTTTTAGCTGGAGCTATTACTATATTACTAACAGATCGAAATTTAAACACTTCTTTTTTTGATCCTGCAGGAGGAGGAGATCCTATTTTATATCAACATTTATTT
Taxon | Reference database | Taxonomy | Identity [%] | evalue | Date of assignment |
---|---|---|---|---|---|
Paratanytarsus inopertus (Walker, 1856) | GBOL | Animalia, Arthropoda, Hexapoda, Insecta, Neoptera, Diptera, Nematocera, Chironomidae, Paratanytarsus, Paratanytarsus inopertus (Walker, 1856) | 100.0000 | 0E-8 | 2022-08-14 10:30:54 |
Paratanytarsus inopertus (Walker, 1856) | GBOL | Animalia, Arthropoda, Hexapoda, Insecta, Neoptera, Diptera, Nematocera, Chironomidae, Paratanytarsus, Paratanytarsus inopertus (Walker, 1856) | 100.0000 | 0E-8 | 2023-05-17 16:56:05 |
Paratanytarsus inopertus Walker, 1856 | BOLD | Arthropoda, Insecta, Diptera, Chironomidae, Chironominae, Paratanytarsus, Paratanytarsus inopertus Walker, 1856 | 100.0000 | 2023-05-17 16:56:05 | |
Paratanytarsus inopertus | NCBI Arthropoda COI | Paratanytarsus inopertus, Paratanytarsus, Chironominae, Chironomidae, Nematocera, Diptera, Pterygota, Insecta, Hexapoda, Arthropoda | 100.0000 | 2024-05-06 10:18:11 |
Occurrences |
Total of 125 occurrences in 152 samples:
ASV table 1 version 1 Download
Total of 22019 occurrences in 106 samples: ASV table 20 version 1 Download Total of 22019 occurrences in 106 samples: ASV table 20 version 2 Download Total of 22019 occurrences in 106 samples: ASV table 20 version 3 Download Total of 22019 occurrences in 106 samples: ASV table 20 version 4 Download Total of 398 occurrences in 61 samples: ASV table 78 version 1 Download Total of 398 occurrences in 61 samples: ASV table 78 version 2 Download Total of 398 occurrences in 61 samples: ASV table 78 version 3 Download Total of 22019 occurrences in 106 samples: ASV table 20 version 5 Download Total of 22019 occurrences in 106 samples: ASV table 20 version 6 Download Total of 125 occurrences in 152 samples: ASV table 116 version 1 Download Total of 125 occurrences in 152 samples: ASV table 116 version 2 Download |