ASV Sequence GBOL_ASV_ID_4809

Date added 2022-08-01 13:21:24
Provided in projects: Project: Björns Testprojekt with original sequence id: 182e43316ac33798205c9bbaeae3244b
Project: Björns Testprojekt with original sequence id: OTU_101
Project: Biodiversity Hotspots in Danish Marine Waters with original sequence id: COI_ASV_919
Project: Sandras Testprojekt with original sequence id: 182e43316ac33798205c9bbaeae3244b
Primers

TCTATCTTCAAGAATTGCTCATAGTGGTGCATCTGTAGATTTAGCAATTTTTTCTTTACATCTAGCAGGAATCTCATCTATTCTTGGATCAGTAAATTTTATTACAACAGCTATTAATATACGTTCAAACGGTATTACTCTTGATCGAATACCTTTATTTGTTTGATCTGTAATTATTACTACTATTTTACTTCTTTTATCTCTCCCAGTTTTAGCTGGAGCTATTACTATATTACTAACAGATCGAAATTTAAACACTTCTTTTTTTGATCCTGCAGGAGGAGGAGATCCTATTTTATATCAACATTTATTT

Taxon Reference database Taxonomy Identity [%] evalue Date of assignment
Paratanytarsus inopertus (Walker, 1856) GBOL Animalia, Arthropoda, Hexapoda, Insecta, Neoptera, Diptera, Nematocera, Chironomidae, Paratanytarsus, Paratanytarsus inopertus (Walker, 1856) 100.0000 0E-8 2022-08-14 10:30:54
Paratanytarsus inopertus (Walker, 1856) GBOL Animalia, Arthropoda, Hexapoda, Insecta, Neoptera, Diptera, Nematocera, Chironomidae, Paratanytarsus, Paratanytarsus inopertus (Walker, 1856) 100.0000 0E-8 2023-05-17 16:56:05
Paratanytarsus inopertus Walker, 1856 BOLD Arthropoda, Insecta, Diptera, Chironomidae, Chironominae, Paratanytarsus, Paratanytarsus inopertus Walker, 1856 100.0000 2023-05-17 16:56:05
Paratanytarsus inopertus NCBI Arthropoda COI Paratanytarsus inopertus, Paratanytarsus, Chironominae, Chironomidae, Nematocera, Diptera, Pterygota, Insecta, Hexapoda, Arthropoda 100.0000 2024-05-06 10:18:11

Occurrences Total of 125 occurrences in 152 samples: ASV table 1 version 1 Download
Total of 22019 occurrences in 106 samples: ASV table 20 version 1 Download
Total of 22019 occurrences in 106 samples: ASV table 20 version 2 Download
Total of 22019 occurrences in 106 samples: ASV table 20 version 3 Download
Total of 22019 occurrences in 106 samples: ASV table 20 version 4 Download
Total of 398 occurrences in 61 samples: ASV table 78 version 1 Download
Total of 398 occurrences in 61 samples: ASV table 78 version 2 Download
Total of 398 occurrences in 61 samples: ASV table 78 version 3 Download
Total of 22019 occurrences in 106 samples: ASV table 20 version 5 Download
Total of 22019 occurrences in 106 samples: ASV table 20 version 6 Download
Total of 125 occurrences in 152 samples: ASV table 116 version 1 Download
Total of 125 occurrences in 152 samples: ASV table 116 version 2 Download