ASV Sequence GBOL_ASV_ID_4809
| Date added | 2022-08-01 13:21:24 |
| Provided in projects: |
Project: Biodiversity Hotspots in Danish Marine Waters with original sequence id: COI_ASV_919 Project: DINA_BN with original sequence id: OTU_33 |
| Primers |
|
TCTATCTTCAAGAATTGCTCATAGTGGTGCATCTGTAGATTTAGCAATTTTTTCTTTACATCTAGCAGGAATCTCATCTATTCTTGGATCAGTAAATTTTATTACAACAGCTATTAATATACGTTCAAACGGTATTACTCTTGATCGAATACCTTTATTTGTTTGATCTGTAATTATTACTACTATTTTACTTCTTTTATCTCTCCCAGTTTTAGCTGGAGCTATTACTATATTACTAACAGATCGAAATTTAAACACTTCTTTTTTTGATCCTGCAGGAGGAGGAGATCCTATTTTATATCAACATTTATTT
| Taxon | Reference database | Taxonomy | Identity [%] | evalue | Date of assignment |
|---|---|---|---|---|---|
| Paratanytarsus inopertus (Walker, 1856) | GBOL | Animalia, Arthropoda, Hexapoda, Insecta, Neoptera, Diptera, Nematocera, Chironomidae, Paratanytarsus, Paratanytarsus inopertus (Walker, 1856) | 100.0000 | 0E-8 | 2022-11-09 13:35:02 |
| Paratanytarsus inopertus Walker, 1856 | BOLD | Arthropoda, Insecta, Diptera, Chironomidae, Chironominae, Paratanytarsus, Paratanytarsus inopertus Walker, 1856 | 100.0000 | 2022-11-09 13:35:02 | |
| Paratanytarsus inopertus | NCBI Arthropoda COI | Paratanytarsus inopertus, Paratanytarsus, Chironominae, Chironomidae, Nematocera, Diptera, Pterygota, Insecta, Hexapoda, Arthropoda | 100.0000 | 2024-05-06 10:18:11 |
| Occurrences |
Total of 398 occurrences in 61 samples:
ASV table 78 version 1 Download
Total of 398 occurrences in 61 samples: ASV table 78 version 2 Download Total of 398 occurrences in 61 samples: ASV table 78 version 3 Download Total of 83 occurrences in 1248 samples: ASV table 155 version 1 Download |