ASV Sequence GBOL_ASV_ID_471
| Date added | 2022-08-01 13:21:24 |
| Provided in projects: |
Project: Sandras Testprojekt with original sequence id: 3c1255164894549ff1e4c4dc25e45250 Project: DINA_BN with original sequence id: OTU_190 |
| Primers |
ATTATCTTCTAATATTGCTCACAGAGGAGCATCTGTTGATCTTGCAATTTTTTCTTTACATTTAGCAGGAATTTCTTCAATTTTAGGATCAGTAAATTTTATTACAACAGTAATTAATATACGATCAAATGGAATTACTTTAGATCGAATACCTTTATTTGTTTGATCGATTGTAATTACAACTGTTTTACTTCTCTTATCATTACCGGTATTAGCCGGAGCTATTACAATATTATTAACTGATCGAAATTTAAATACATCATTTTTTGATCCTGCTGGTGGGGGAGACCCTATTTTATACCAACATTTATTT
| Taxon | Reference database | Taxonomy | Identity [%] | evalue | Date of assignment |
|---|---|---|---|---|---|
| Microtendipes | GBOL | Animalia, Arthropoda, Hexapoda, Insecta, Neoptera, Diptera, Nematocera, Chironomidae, Microtendipes | 100.0000 | 0E-8 | 2023-05-17 16:56:05 |
| Microtendipes confinis | BOLD | Arthropoda, Insecta, Diptera, Chironomidae, Chironominae, Microtendipes, Microtendipes confinis | 100.0000 | 2023-05-17 16:56:05 |
| Occurrences |
Total of 12833 occurrences in 152 samples:
ASV table 116 version 1 Download
Total of 12833 occurrences in 152 samples: ASV table 116 version 2 Download Total of 176 occurrences in 1248 samples: ASV table 155 version 1 Download |