ASV Sequence GBOL_ASV_ID_450
| Date added | 2022-08-01 13:21:24 |
| Provided in projects: |
Project: Sandras Testprojekt with original sequence id: 002bc03c6f5dd29913d464020fc821e9 Project: DINA_BN with original sequence id: OTU_11343 |
| Primers |
ATTATCTTTAAATATTGGTCATAGGGGAATATCAGTAGATTTAGCTATTTTTTCTTTACATATAGCTGGAATTTCTTCAATTATAGGAGCTATTAATTTTATTTCAACTATTATAAATATACGTCCTATTTATATAACAATAGATAAAATTTCTTTATTGAGTTGGTCTATTTTAATTACTACAATTTTATTGTTATTATCTCTTCCTGTTTTAGCAGGGGCTATTACAATATTATTAACAGATCGTAATTTAAATACTTCATTTTTTGATCCTGCTGGTGGAGGAGATCCTATTTTATATCAACATTTATTT
| Taxon | Reference database | Taxonomy | Identity [%] | evalue | Date of assignment |
|---|---|---|---|---|---|
| Blacus ruficornis Nees, 1811 | BOLD | Arthropoda, Insecta, Hymenoptera, Braconidae, Brachistinae, Blacus, Blacus ruficornis Nees, 1811 | 100.0000 | 2023-05-17 16:56:05 | |
| Blacus ruficornis (Nees, 1811) | GBOL | Animalia, Arthropoda, Hexapoda, Insecta, Neoptera, Hymenoptera, Braconidae, Blacus, Blacus ruficornis (Nees, 1811) | 100.0000 | 0E-8 | 2025-07-06 16:38:03 |
| Occurrences |
Total of 5 occurrences in 152 samples:
ASV table 116 version 1 Download
Total of 5 occurrences in 152 samples: ASV table 116 version 2 Download Total of 2 occurrences in 1248 samples: ASV table 155 version 1 Download |