ASV Sequence GBOL_ASV_ID_388

Date added 2022-08-01 13:21:24
Provided in projects: Project: Björns Testprojekt with original sequence id: OTU_185
Project: Sandras Testprojekt with original sequence id: 8c4aacf0554b843a32b02d51756e2bd3
Project: Test 20250115 with original sequence id: OTU_185
Project: DINA_BN with original sequence id: OTU_2016
Project: DSUB-578 with original sequence id: P142690-2025-306
Primers

ACTATCATCTAATATTGCCCATGGAGGTAGATCTGTAGATCTAGCTATTTTCTCACTTCATCTAGCCGGAATTTCATCAATTTTAGGAGCTATTAATTTTATTACTACAATTATTAATATACGTTTAAATAATTTATCATTTGATCAAATACCATTATTTATTTGAGCTGTAGGAATTACTGCATTCTTATTATTAATTTCATTACCGGTATTAGCAGGAGCTATTACTATACTTTTAACTGACCGTAATTTAAATACATCATTCTTTGATCCTGCTGGAGGAGGAGACCCAATTTTATATCAACATTTATTT

Taxon Reference database Taxonomy Identity [%] evalue Date of assignment
Cucullia umbratica Linnaeus, 1758 BOLD Arthropoda, Insecta, Lepidoptera, Noctuidae, Cuculliinae, Cucullia, Cucullia umbratica Linnaeus, 1758 100.0000 2024-01-19 19:50:35
Cucullia umbratica (Linnaeus, 1758) GBOL Animalia, Arthropoda, Hexapoda, Insecta, Neoptera, Lepidoptera, Noctuoidea, Noctuidae, Cuculliinae, Cucullia, Cucullia, Cucullia umbratica (Linnaeus, 1758) 100.0000 0E-8 2025-07-06 16:38:03

Occurrences Total of 8384 occurrences in 69 samples: ASV table 4 version 1 Download
Total of 1 occurrences in 30 samples: ASV table 42 version 5 Download
Total of 18 occurrences in 152 samples: ASV table 116 version 1 Download
Total of 18 occurrences in 152 samples: ASV table 116 version 2 Download
Total of 8382 occurrences in 60 samples: ASV table 153 version 1 Download
Total of 30 occurrences in 1248 samples: ASV table 155 version 1 Download
Total of 72 occurrences in 98 samples: ASV table 160 version 1 Download