ASV Sequence GBOL_ASV_ID_360565

Date added 2026-01-23 10:23:58
Provided in projects: Project: DSUB-599 with original sequence id: P142690-2025Nov-5121
Primers
fwhF2, fwhR2n

TCTCTCATCTACTATATCGCATTCAGGGGCATCAGTTGATCTATCAATTTTTTCATTGCATTTAGCTGGTATTTCATCTATTTTAGGGGCAGTAAACTTTATTTCAACTATTATTAATATGCGGACACCAGGGATATCTTTTGATAAAATACCTTTATTTGTTTGATCAGTATTAATTACTGCTGTATTATTATTACTTTCATTA

Taxon Reference database Taxonomy Identity [%] evalue Date of assignment
Pseudolycoriella brunnea from ASV table 174 Arthropoda, Insecta, Diptera, Sciaridae, Pseudolycoriella, Pseudolycoriella brunnea 100.0000 2026-01-26 14:00:54

Occurrences Total of 187 occurrences in 141 samples: ASV table 174 version 1 Download