ASV Sequence GBOL_ASV_ID_360559
| Date added | 2026-01-23 10:23:58 |
| Provided in projects: |
Project: DSUB-599 with original sequence id: P142690-2025Nov-1783 |
| Primers |
fwhF2, fwhR2n |
CCTATCCTCTAATATTGCTCATGGAGGGGCTTCTGTCGATTTAGCAATTTTCTCATTACATTTAGCGGGAATTTCATCAATTCTAGGAGCAGTAAATTTTATTACCACAGTAATTAATATACGATCTACAGGTATTACCTTCGATCGAATACCTTTATTTGTATGATCGGTAGTAATTACCGCCTTATTATTACTTCTTTCTTTG
| Taxon | Reference database | Taxonomy | Identity [%] | evalue | Date of assignment |
|---|---|---|---|---|---|
| Blaesoxipha plumicornis | from ASV table 174 | Arthropoda, Insecta, Diptera, Sarcophagidae, Blaesoxipha, Blaesoxipha plumicornis | 100.0000 | 2026-01-26 14:00:54 |
| Occurrences |
Total of 3309 occurrences in 141 samples:
ASV table 174 version 1 Download
|