ASV Sequence GBOL_ASV_ID_360533

Date added 2026-01-23 10:23:58
Provided in projects: Project: DSUB-599 with original sequence id: P142690-2025Nov-2511
Primers
fwhF2, fwhR2n

ACTATCATCTTACTCTTTCCATCCATCGTCATCAGTAGATTTGACAATCTTCTCTCTTCATATTGCAGGAGTTTCATCAATTATAGGAGCAATTAACTTTATTGTCACAATTCTAAATATAAAAAATATTTCACTAAACTATGACCAACTTCCACTATTCCCATGATCAGTATTTATTACCACAATTCTACTACTAATTTCATTA

Taxon Reference database Taxonomy Identity [%] evalue Date of assignment
Andrena dorsata from ASV table 174 Arthropoda, Insecta, Hymenoptera, Andrenidae, Andrena, Andrena dorsata 100.0000 2026-01-26 14:00:54

Occurrences Total of 1391 occurrences in 141 samples: ASV table 174 version 1 Download