ASV Sequence GBOL_ASV_ID_34819
| Date added | 2022-08-02 06:12:02 |
| Provided in projects: |
Project: DSUB-558 with original sequence id: P142690-390 Project: Introduction asv registry with original sequence id: P142690-2025-6583 Project: Introduction asv registry with original sequence id: P142690-390 Project: smf_dummy with original sequence id: P142690-2025-6583 |
| Primers | mlCOIintF, dgHCO2198 |
ATTATCATCAATTACATATCATCCATCAATATCCGTAGACCTTACAATTTTTTCACTTCATATTGCTGGTATTTCATCAATTATAGGAGCTATTAATTTCATCGTAACAATTATAAATATAAAAAATATTAATTTAAATTATGATCAAATAAATCTATTTTCATGATCAGTAATAATTACTGCAATTCTATTACTTTTATCCTTGCCTGTTCTTGCAGGAGCAATTACCATATTATTAACAGATCGTAATTTTAATACATCATTCTTTGACCCATCTGGAGGAGGAGACCCAATTCTATATCAACATTTATTT
| Taxon | Reference database | Taxonomy | Identity [%] | evalue | Date of assignment |
|---|---|---|---|---|---|
| Hylaeus_communis | from ASV table 168 | Arthropoda, Insecta, Hymenoptera, Colletidae, Hylaeus, Hylaeus_communis | 2025-12-03 13:23:57 | ||
| Hylaeus_communis | from ASV table 170 | Arthropoda, Insecta, Hymenoptera, Colletidae, Hylaeus, Hylaeus_communis | 2025-12-04 23:59:38 | ||
| Hylaeus communis Nylander, 1852 | GBOL | Animalia, Arthropoda, Hexapoda, Insecta, Neoptera, Hymenoptera, Colletidae, Hylaeinae, Hylaeus, Hylaeus communis Nylander, 1852 | 100.0000 | 0E-8 | 2025-12-05 00:00:47 |
| Occurrences |
Total of 4 occurrences in 63 samples:
ASV table 154 version 1 Download
Total of 62 occurrences in 98 samples: ASV table 160 version 1 Download Total of 62 occurrences in 98 samples: ASV table 168 version 1 Download Total of 0 occurrences in 63 samples: ASV table 170 version 1 Download Total of 62 occurrences in 98 samples: ASV table 173 version 1 Download |