ASV Sequence GBOL_ASV_ID_34509
| Date added | 2022-08-02 06:12:02 |
| Provided in projects: |
Project: DSUB-558 with original sequence id: P142690-889 Project: Introduction asv registry with original sequence id: P142690-889 |
| Primers |
mlCOIintF, dgHCO2198 |
TCTTTCTAATAATATTGCCCATAATAATATTTCAGTAGATTTAACTATTTTTTCATTACATTTAGCAGGAATTTCCTCTATTTTAGGAGCTATCAATTTTATTTGTACGATCTTAAATATAATACCTCATAATTTAAAAATTAATCAAATCCCCCTATTCCCATGATCAATCCTAATTACAGCAACTTTATTAATTTTGTCATTACCAGTTTTAGCTGGTGCAATTACCATATTATTAACTGATCGAAATCTAAATACATCATTCTTTGACCCATCCGGTGGAGGAGACCCTATTTTATATCAACATCTATTC
| Taxon | Reference database | Taxonomy | Identity [%] | evalue | Date of assignment |
|---|---|---|---|---|---|
| Anoecia | from ASV table 170 | Arthropoda, Insecta, Hemiptera, Aphididae, Anoecia | 2025-12-04 23:59:38 | ||
| Anoecia | GBOL | Animalia, Arthropoda, Hexapoda, Insecta, Neoptera, Sternorrhyncha, Aphidoidea, Aphididae, Anoecia | 100.0000 | 0E-8 | 2025-12-05 00:00:47 |
| Occurrences |
Total of 4 occurrences in 63 samples:
ASV table 154 version 1 Download
Total of 0 occurrences in 63 samples: ASV table 170 version 1 Download |