ASV Sequence GBOL_ASV_ID_230
Date added | 2022-08-01 13:21:24 |
Provided in projects: |
Project: Björns Testprojekt with original sequence id: OTU_1231 Project: Björns Testprojekt with original sequence id: c2489699c2f7b42ec82838e3e262caa4 Project: Sandras Testprojekt with original sequence id: c2489699c2f7b42ec82838e3e262caa4 Project: Test 20250115 with original sequence id: OTU_1231 Project: DINA_BN with original sequence id: OTU_1392 Project: DSUB-578 with original sequence id: P142690-2025-3514 |
Primers |
TCTATCATCAACAATTGCCCACGGAGGAGCATCAGTTGATTTAGCAATTTTTTCATTACATTTAGCTGGAGTATCATCTATTTTAGGAGCTGTTAATTTTATTACTACAGTAATTAATATACGATCAATTGGAATTACTTTTGATCGAATACCTTTATTTGTTTGATCTGTAGTTATTACAGCTCTTCTATTACTTTTATCTTTACCAGTATTAGCAGGAGCAATTACTATATTATTAACTGATCGAAATTTAAATACTTCATTTTTTGATCCAGCCGGAGGAGGAGATCCAATTCTTTACCAACATTTATTC
Taxon | Reference database | Taxonomy | Identity [%] | evalue | Date of assignment |
---|---|---|---|---|---|
Chalarus spurius Fallen, 1816 | BOLD | Arthropoda, Insecta, Diptera, Pipunculidae, Chalarinae, Chalarus, Chalarus spurius Fallen, 1816 | 100.0000 | 2023-09-01 09:07:40 | |
Chalarus spurius (Fallén, 1816) | GBOL | Animalia, Arthropoda, Hexapoda, Insecta, Neoptera, Diptera, Cyclorrhapha, Pipunculidae, Chalarus, Chalarus spurius (Fallén, 1816) | 100.0000 | 0E-8 | 2025-07-06 16:38:03 |
Occurrences |
Total of 614 occurrences in 69 samples:
ASV table 4 version 1 Download
Total of 347 occurrences in 5 samples: ASV table 112 version 1 Download Total of 0 occurrences in 30 samples: ASV table 42 version 5 Download Total of 117 occurrences in 152 samples: ASV table 116 version 1 Download Total of 117 occurrences in 152 samples: ASV table 116 version 2 Download Total of 614 occurrences in 60 samples: ASV table 153 version 1 Download Total of 93 occurrences in 1248 samples: ASV table 155 version 1 Download Total of 44 occurrences in 98 samples: ASV table 160 version 1 Download |