ASV Sequence GBOL_ASV_ID_116765
Date added | 2022-11-09 13:28:54 |
Provided in projects: |
Project: Biodiversity Hotspots in Danish Marine Waters with original sequence id: COI_ASV_1918 |
Primers |
TTTATCAAGAAATATTGCTCACTCTGGAGCATCTGTGGATTTATCAATTTTTTCTCTCCATTTAGCGGGAGCTTCTTCAATTCTAGGAGCAATTAATTTTATATCCACAGTTATTAATATACGAGCAGAAACTTTAACTTTTGATCGTCTTCCTCTTTTTGTATGAAGAGTATTTATTACAGTAATTTTACTTCTACTATCACTCCCTGTTTTAGCAGGAGCTATTACAATACTACTTACAGATCGAAATCTAAATACTTCGTTTTTTGACCCTACAGGAGGAGGTGATCCTATTCTTTATCAACATTTATTC
Taxon | Reference database | Taxonomy | Identity [%] | evalue | Date of assignment |
---|---|---|---|---|---|
Balanus crenatus Bruguière, 1789 | BOLD | Arthropoda, Thecostraca, Sessilia, Balanidae, Balaninae, Balanus, Balanus crenatus Bruguière, 1789 | 100.0000 | 2022-11-09 13:35:02 | |
Balanus crenatus | NCBI Arthropoda COI | Balanus crenatus, Balanus, Balaninae, Balanidae, Balanomorpha, Cirripedia, Thecostraca, Crustacea, Arthropoda | 100.0000 | 2024-05-06 10:18:11 |
Occurrences |
Total of 3 occurrences in 61 samples:
ASV table 78 version 1 Download
Total of 3 occurrences in 61 samples: ASV table 78 version 2 Download Total of 3 occurrences in 61 samples: ASV table 78 version 3 Download |