ASV Sequence GBOL_ASV_ID_116735
| Date added | 2022-11-09 13:28:54 |
| Provided in projects: |
Project: Biodiversity Hotspots in Danish Marine Waters with original sequence id: COI_ASV_362 |
| Primers |
TCTCTCAAGTAAAATAGCCCACGCCGGGGGGTCCGTTGACCTAGCGATTTTTTCTCTACATCTTGCAGGAGCTTCCTCTATTTTAGCCTCAATTAACTTTATTACTACAATTATTAATATGCGAACACCAGGAATGTCATTTGATCGCCTACCTCTATTTGTTTGGTCCGTATTTGTCACAGCGTTCTTGCTATTGTTATCCTTACCAGTATTGGCTGGGGCGATTACTATGCTTTTAACAGACCGAAATATTAATACTACATTCTTTGACCCAGCAGGAGGAGGAGACCCCATTCTATTCCAGCACTTATTC
| Taxon | Reference database | Taxonomy | Identity [%] | evalue | Date of assignment |
|---|---|---|---|---|---|
| Psammechinus miliaris (P.L.S. Müller, 1771) | BOLD | Echinodermata, Echinoidea, Camarodonta, Echinidae, Psammechinus, Psammechinus miliaris (P.L.S. Müller, 1771) | 100.0000 | 2022-11-09 13:35:02 |
| Occurrences |
Total of 0 occurrences in 61 samples:
ASV table 78 version 1 Download
Total of 0 occurrences in 61 samples: ASV table 78 version 2 Download Total of 0 occurrences in 61 samples: ASV table 78 version 3 Download |