ASV Sequence GBOL_ASV_ID_1121

Date added 2022-08-01 13:21:24
Provided in projects: Project: DSUB-578 with original sequence id: P142690-2025-4797
Project: Introduction asv registry with original sequence id: P142690-2025-4797
Project: smf_dummy with original sequence id: P142690-2025-4797
Primers
mlCOIintF, dgHCO2198

ACTTTCTTCTATTATTGCCCATACAGGATCATCCGTTGATTTTTCAATTTTTTCATTACATATTGCTGGAATTTCATCAATTTTAGGGGCAATTAATTTTATTTCAACAATATTAAATATAAAAATTAAATTTTTAAAATTTGACCAAATTTCTTTATTTATTTGATCTATTTTAATTACTACTGTATTATTATTATTATCTTTACCAGTTTTAGCTGGAGCAATTACTATATTATTAACAGATCGTAATTTAAACACTTCTTTCTTTGACCCTATAGGAGGAGGAGATCCTATTTTATATCAACATTTATTT

Taxon Reference database Taxonomy Identity [%] evalue Date of assignment
Cecidomyiidae from ASV table 168 Arthropoda, Insecta, Diptera, Cecidomyiidae 2025-12-03 13:23:57

Occurrences Total of 3 occurrences in 98 samples: ASV table 160 version 1 Download
Total of 3 occurrences in 98 samples: ASV table 168 version 1 Download
Total of 3 occurrences in 98 samples: ASV table 173 version 1 Download