ASV Sequence GBOL_ASV_ID_1121
| Date added | 2022-08-01 13:21:24 |
| Provided in projects: |
Project: DSUB-578 with original sequence id: P142690-2025-4797 Project: Introduction asv registry with original sequence id: P142690-2025-4797 Project: smf_dummy with original sequence id: P142690-2025-4797 |
| Primers | mlCOIintF, dgHCO2198 |
ACTTTCTTCTATTATTGCCCATACAGGATCATCCGTTGATTTTTCAATTTTTTCATTACATATTGCTGGAATTTCATCAATTTTAGGGGCAATTAATTTTATTTCAACAATATTAAATATAAAAATTAAATTTTTAAAATTTGACCAAATTTCTTTATTTATTTGATCTATTTTAATTACTACTGTATTATTATTATTATCTTTACCAGTTTTAGCTGGAGCAATTACTATATTATTAACAGATCGTAATTTAAACACTTCTTTCTTTGACCCTATAGGAGGAGGAGATCCTATTTTATATCAACATTTATTT
| Taxon | Reference database | Taxonomy | Identity [%] | evalue | Date of assignment |
|---|---|---|---|---|---|
| Cecidomyiidae | from ASV table 168 | Arthropoda, Insecta, Diptera, Cecidomyiidae | 2025-12-03 13:23:57 |
| Occurrences |
Total of 3 occurrences in 98 samples:
ASV table 160 version 1 Download
Total of 3 occurrences in 98 samples: ASV table 168 version 1 Download Total of 3 occurrences in 98 samples: ASV table 173 version 1 Download |